Polymerase Chain Reaction

Consideration During Primer Design

 

 

The primer design should concern about: 

 

• Primer should usually be 17-28 bases long

• Need as much sequence information as possible outside target

• Best to have G or C at 3’ end

• Tms between 55-80°C are preferred

• Aim for 40-60% GC content

• Primers should have approximately equal melting temperatures

• Avoid repetitive sequences

• Avoid complementarity within or between primers

 

 

Example

• Sample sequence and primers

               Note how sequence of reverse primer relates to that of target sequence: remember 5’ to 3’ convention.

 

• Target sequence (priming sites underlined) :                                                                                                                                           5'TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATCATATGG                                                                                                  TGAGAAATGCTTGTGGAGCTGATGTTGATTTGGAGAGACTCTCTCTC                                                                                                 TCTCTCTCTCTCTCTCTCTCTCAAACCAGTTAAAGAGTGTGCCAGTAGAG3'

 

 

                                        Forward primer:  5’ATG GAT GAG AAA TGC TTG TG3’

                                        Reverse primer:  5’ACT GGC ACA CTC TTT AAC TGG3'